journal_list | How to participate | E-utilities
주요 임상 내성균에 대한 어성초 에탄올 추출물의 항균효과

초록

다제내성균의 증가는 사용할 항생제가 적거나 심지어 선택할 항생제가 없기 때문에 감염환자의 치료에 커다란 위협이 되고 있다. 최근 다양한 천연 추출물이 내성세균에서 항균효과 및 상승효과를 보인다는 보고가 많다. 어성초(Houttuynia cordata)는 항균, 항바이러스 및 항산화 효과를 보이는 전통적 약초이다. 이에 저자들은 임상의 주요 내성균에 대한 어성초의 항균효과를 알아보고, 이들의 적절한 항균효과 측정방법을 평가하고자 한다. 우선 현재 가장 많은 문제를 야기하는 주요 내성균인 methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant Enterococcus faecium (VRE), carbepenem-resistant Acinetobacter baumannii (CRAB) 각각 10 균주를 선택하여, CLSI 기준으로 디스크 확산법 및 미량액체배지희석법으로 감수성 시험을 하였다. CLSI 기준으로 시행한 디스크 확산법에서 4,096 μg/mL에서 30,000 μg/mL 까지의 농도에서 모든 균의 억제대는 관찰되지 않았다. 그러나 액체배지 희석법에서는 MRSA, VRE, CRAB의 MIC90이 각각 4,096 μg/mL, 8,192 μg/mL, 4,096 μg/mL를 보였다. 결론적으로 어성초는 MRSA, VRE, CRAB 등 주요 임상 내성균에서 우수한 항균효과를 보이며 천연물의 항균효과를 평가에 디스크 확산법보다 액체배지 희석법이 유용하다고 할 수 있다. 만약 디스크 확산법으로 항균효과를 측정하려면 천연물에 대한 균 접종 농도의 변경 등 새로운 기준이 요구된다.

Abstract

The increase in resistance by pathogenic bacteria to multiple antimicrobial agents has become a significant treat, as the effective antimicrobial agents available for the patients infected by such resistant bacteria are reduced, or even eliminated. Several natural plant extracts have exhibited antibacterial and synergistic activity against various resistant microorganisms. Houttuynia cordata is frequently used by many traditional medicine practicioners for its antimicrobial, antiviral, and anti-inflammatory properties. This study investigated the antibacterial effects of H. cordata extract against clinical multi-resistant bacteria, and compared the two methods used for the antimicrobial susceptibility testing. Thirty isolates of Methicillin-resistant Staphylococcus aureus (MRSA, 10), Vancomycin-resistant Enterococcus faecium (VRE, 10), Carbapenem-resistant Acinetobacter baumannii (CRAB, 10) were included in this study. The antibacterial effect of H. cordata was tested by disk diffusion and microbroth dilution methods as per CLSI guidelines. In disk diffusion, all isolates (30) showed no inhibition to 30,000 μg/mL of H. cordata. But in the microbroth dilution method, MIC90 of H. cordata was 4,096 μg/mL, 8,192 μg/mL and 4,096 μg/mL in MRSA, VRE and CRAB, respectively. These results demonstrate that H. cordata exhibits antibacterial activity against MRSA, VRE and CRAB. Moreover, the microbroth dilution method is a more effective method than disk diffusion to evaluate the antibacterial activity of natural products. The Disk diffusion method used to evaluate the antibacterial activity of natural products required new standard guidelines including inoculum concentration of bacteria.

서론

최근 methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant enterococci (VRE), carbapenem resistance Acinetobacter baumannii (CRAB)과 같은 다제내성 세균의 증가가 보고되고 있으며(Kim 등, 2012; Yang 등, 2013; Chung 등, 2014), 저자들은 2004∼2013년 동안 3차 의료기관 소변배양검사결과에서 MRSA (68%→69%), VRE (18%→26%) 그리고 ESBL (8.9%→28%)의 의미있는 증가를 보고하였다(Hong 등, 2015). 이러한 내성세균의 증가는 감염병치료에 많은 어려움을 야기하고 있으며 전통약물 같은 천연자원에 존재하는 항균성 물질을 치료에 이용하고자 하는 연구가 활발히 수행되고 있다(Liu 등, 2000; Jo 등, 2013). 여러 종류의 천연물질에 대한 항균효과 논문들이 많이 보고되고 있지만 주로 대장균 또는 식중독 및 일반병원세균에 대한 논문들이 대부분이다. 그리고 내성세균에 대한 천연물질의 항균효과는 대부분 MRSA에 대한 연구만 보고되어 있는 실정이다(Shin과 Sung, 2006; Amin 등, 2015). 따라서 현재 임상에서 문제를 야기하고 있는 다양한 내성균에 대한 항균효과에 대한 연구가 필요하다.
어성초(Houttuynia cordata)는 삼백초과(Saururaceae)에 속하는 다년생 야생 약초로서 중국, 일본 및 한국에서 전통약용 식물로 사용되며, 수종, 매독, 방광염, 자궁염, 폐렴 및 중풍 등 광범위한 지표효과가 있는 것으로 보고되고 있다(Song 등, 2003). 또한 항균(Kim 등, 2008; Cho 등, 2008), 항산화(Jeong 등, 2010), 항아토피(Park 등, 2012), 항암(Kim 등, 2001)효과에 대한 연구들이 보고되었다. 특히 항균에 대한 논문은 매우 많이 보고되고 있는데, 항균효과에 사용되는 검사방법이 논문마다 상이하여 결과를 비교하기에 매우 어려움이 많다(Jang 등, 2008; Lee 등, 2011). 특히 균 접종 농도를 표기하지 않은 경우도 있으며(Jo 등, 2013), 실험에 사용되는 천연물질의 농도 단위표기가 논문마다 다른 것을 볼 수 있었다(Song 등, 2003; Kim 등, 2008). 이에 본 연구에서는 병원 미생물 검사실에서 통상적으로 사용되며 Clinical Laboratory Standard Institute (CLSI, 2012) 기준을 사용한 디스크 확산법과 미량액체배지희석법을 사용하여 다제내성균에 대한 어성초의 항균효과를 측정하였다.

재료 및 방법

1. 어성초 시료의 준비

어성초는 천안 소재 고려약업사에서 구입하여 분쇄한 후 70% 에탄올 100 mL에 전초 5 g을 넣어(v/w) 2 시간 가압 가열 추출한 후 여과지(No. 2; Whatman Inc., Kent, UK)로 여과하여 진공회전농축기(Eylya Co., Tokyo, Japan)을 이용하여 농축하고 동결 건조하여 냉동보관(−20°C)하면서 사용하였다. 추출된 분말은 DMSO에 녹여 100 mg/mL로 만든 후 각 실험농도를 조정하여 사용하였다.

2. 균주의 수집

2014년 충북지역 3차 의료기관에서 S. aureus, Enterococcus faeciumA. baummannii를 수집하였다. 이들 균주에서 MRSA를 선별하기 위해 mecA 유전자를, VRE를 선별하기 위해 vanAvanB 유전자의 검출을 시도하였다. 마지막으로 CRAB를 선별하기 위해 blaOXA23을 검출하였다. 최종적으로 MRSA, VRE, 및 CRAB 각각 10 균주를 대상으로 하였다. S. aureus ATCC 29213, E. faecalis 29212, Pseudomonas aeruginosa ATCC 27853을 항균효과 검사시 대조균주로 사용하였다. 균주의 동정은 VITEK II 자동화 장비(bioMerieux Inc., Hazelwood, MO, USA)를 이용하였다.

3. PCR을 이용한 내성 유전자 검출

1) S. aureus에서 mecA 유전자 검출

S. aureus에서 methicillin 내성유무를 결정하는 mecA 유전자 검출하여 MRSA 유무를 판단하였다. mecA 유전자 검출에 사용된 primer 및 조건은 Table 1과 같다.
Table 1
Oligonucleotide primers for used in this study
Primer Target gene Sequence (5’→3’) Reference
 OXA23- F blaOXA23 GATCGGATTGGAGAACCAGA Woodford et al., 2006
 OXA23-R ATTTCTGACCGCATTTCCAT
 mecA-F mecA ATGAGATTAGGCATCGTTCC Brakstad et al., 1992
 mecA-R TGGATGACAGTACCTGAGCC
 vanA-F vanA GGGAAAACGACAATTGC Depardieu et al., 2004
 vanA-R GTACAATGCGGCCGTTA
 vanB–F vanB ACGGAATGGGAAGCCGA
 vanB-R TGCACCCGTTTCGTTC

Abbreviations: F, forward; R, reverse.

2) E. faecium에서 vanA, vanB 유전자 검출

E. faecium에서 vancomycin 내성유무를 결정하는 vanAvanB 유전자를 검출하여 VRE 유무를 판단하였으며 이들 유전자의 검출에 사용된 primer 및 조건은 Table 1과 같다.

3) A. baumanni에서 blaOXA23 유전자 검출

A. baumannii에서 carbapenemase 생성(내성) 균주를 검출하기 위해서 blaOXA23 유전자를 이용하였으며 사용된 primer 및 조건은 Table 1과 같다.

4. 항균효과 측정

1) 디스크 확산법을 이용한 항균력 검사

CLSI 기준(CLSI, 2012)에 따라 혈액한천배지(BAP) 또는 MacConkey 배지에 배양 된 균을 식염수에 풀어 탁도를 McFarland 0.5관(1.5×108 CFU/mL)에 맞춘 후 Muller-Hinton (Asan Co, Seoul) 배지에 접종하고 빈 디스크를 올려 놓은 후 어성초 추출물을 각각 4,096 μg/mL, 8,196 μg/mL, 10,000 μg/mL, 20,000 μg/mL, 30,000 μg/mL의 농도 20 μL를 빈 디스크에 분주하였다. 분주 후 시료가 디스크에 스며들도록 30분 방치 후 35°C 18시간 배양 하여 억제대의 크기를 측정하였다. 용매제의 영향 유무를 위해 10% DMSO을 시료와 동일한 조건으로 사용하였다.

2) 미량액체배지 희석법을 이용한 항균력 검사

Microplate에 어성초 1,024∼8,196 μg/mL 범위의 농도를 각각 100 μL를 넣은 후 아래농도의 균액을 넣고 35°C에서 16∼18시간 배양 후 MIC를 판독하였다(Jorgensen JH & Turnidge, 2007). 균접종 농도는 CLSI 기준(CLSI, 2012)에 따라 BAP 및 MacConkey 배지에 배양 된 균을 식염수에 풀어 탁도를 McFarland 0.5관에 맞춘 후 10배 희석하여 1×107 CFU/mL로 만들었다. 이어서 Muller-Hinton broth에 희석하여 최종 균 농도를 5×105 CFU/mL로 하였다. 매 검사마다 S. aureus ATCC 29213, E. faecalis 29212, P. aeruginosa ATCC 27853를 대조 균주로 사용하였다. MIC의 판독은 어성초의 색소로 인한 육안판독이 어려워 Hong 등(2013년 대한임상검사정도관리협회 학술연구과제 결과보고서)의 방법에 따라 MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) 염료를 10 μL 첨가하고 30분 방치 후 색 변화(보라색으로 변함: 증식을 의미)를 육안으로 확인하여 증식 유무를 판독하였다. 즉 색의 변화가 나타나지 않은(균이 증식하지 못한) 최소농도를 MIC로 판독하였다.

결과

1. 균주의 임상적 특징 및 내성유전자 검출

mecA 양성 S. aureus (MRSA) 10 균주는 혈액과 소변에서 분리되었으며 모든 균주가 oxacillin에 내성이고 vancomycin에 감수성이었다(Table 2). Vancomcyin-resistant Enterococci는 rectal swab과 소변에서 분리되었으며 모든 균주가 vanA 를 가지고 있었으며 vancomycin을 포함한 5종류의 항균제 모두 내성이었다(Table 3). A. baumannii는 10 균주 모두가 blaOXA23 내성유전자를 가지고 있었으며 imipenem을 포함한 6 종류의 항균제에 내성을 보였다(Table 4).
Table 2
The characteristics of methicillin-resistant Staphylococcus aureus (MRSA) and antibacterial activity of Houttuynia cordata against MRSA
Strain No. Specimen mecA* Antimicrobial susceptibility of MRSA Antibacterial activity of H. cordata


OX VA CIP GM PG E TE Inhibition (mm) by DD MIC (μg/mL) by MBD
1 WB + R S R R R R R No inhibition 4,096
2 WB + R S R R R R R No inhibition 4,096
3 WB + R S R R R R R No inhibition 4,096
4 WB + R S R R R R R No inhibition 4,096
5 WB + R S S S R R S No inhibition 4,096
6 WB + R S R R R R R No inhibition 4,096
7 WB + R S R R R R R No inhibition 4,096
8 WB + R S R R R R R No inhibition 4,096
9 urine + R S R S R R R No inhibition 4,096
10 WB + R S R R R R R No inhibition 4,096
C ATCC - S S S S S S S No inhibition 4,096

Abbreviations: C, control strain; WB, whole bood; OX, oxacillin; VA, vancomycin; CIP, ciprofloxacin; GM, gentamicin; PG, penicillin G; E, erythromycin; TE, tetracycline; R, resistant; S, susceptible; DD, disk diffusion method; MBD, microbrothdilution method.

* gene causing the resistance of methicillin in Staphylococcus aureus;

The concentrations of H. cordata ethanol extrat used were from 4,096 μg/mL to 30,000 μg/mL;

Staphylococcus aureus ATCC 29213.

Table 3
The characteristics of vancomycin-resistant Enteroocccus faecium (VRE) and antibacterial activity of Houttuynia cordata against VRE
Strain No. Specimen vanA* vanB* Antimicrobial susceptibility Antibacterial activity of H. cordata


VA TEI AM CIP E Inhibition (mm) by DD MIC (μg/mL) by MBD
1 RS + - R R R R R No inhibition 8,192
2 RS + - R R R R R No inhibition 4,096
3 RS + - R R R R R No inhibition 4,096
4 RS + - R R R R R No inhibition 4,096
5 RS + - R R R R R No inhibition 4,096
6 RS + - R R R R R No inhibition 8,192
7 RS + - R R R R R No inhibition 8,192
8 urine + - R R R R R No inhibition 8,192
9 urine + - R R R R R No inhibition 8,192
10 RS + - R R R R R No inhibition 8,192
C ATCC - - S S S S S No inhibition 8,192

Abbreviations: RS, rectal swab; VA, vancomycin; TEI, teicoplanin; AM, ampicillin; CIP, ciprofloxacin; E, erythromycin; R, resistant; DD, disk diffusion method; MBD, microbrothdilution method.

* Gene causing the resistance of vancomycin in Enterococcus spp.;

The concentrations of H. cordata ethanol extrat used were from 4,096 μg/mL to 30,000 μg/mL;

Enterococcus faecalis ATCC 29212.

Table 4
The characteristics of carbapenem-resistant Acinetobacter baumannii (CRAB) and antibacterial activity of Houttuynia cordata against CRAB
Strain No. Specimen blaOXA23* Antimicrobial susceptibility of MRSA Antibacterial activity of H. cordata


IP AK CIP GM TM CTZ Inhibition (mm) by DD MIC (μg/mL) by MBD
1  WB + R R R R R R No inhibition 8,192
2  SPU + R R R R R R No inhibition 4,096
3  SPU + R R R R R R No inhibition 4,096
4  WB + R R R R R R No inhibition 4,096
5  SPU + R R R R R R No inhibition 4,096
6  SPU + R R R R R R No inhibition 4,096
7  SPU + R R R R R R No inhibition 4,096
8  SPU + R R R R R R No inhibition 4,096
9  BA + R R R R R R No inhibition 4,096
10  SPU + R R R R R R No inhibition 4,096
C  ATCC - S S S S S S No inhibition 4,096

Abbreviations: WB, whole bood; SPU, sputum; BA, broncheal aspirate; IP, imipnem; AK, amikacin; CIP, ciprofloxacin; GM, gentamicin; TM, tobramycin; CTZ, ceftazidime; R, resistant; DD, disk diffusion method; MBD, microbrothdilution method.

* gene causing hydrolysis of carbapenem (eg, imipenem);

concentrations of H. cordata ethanol extrat used were from 4,096 μg/mL to 30,000 μg/mL;

Pseudomonas aeruginosa ATCC 27853

2. 항균 활성의 검사

1) 디스크 확산법을 이용한 항균력 검사

MRSA, VRE 및 CRAB 세균배양에서 DMSO의 경우 억제대를 관찰할 수 없어 어성초 추출물의 희석액으로 적절함을 확인한 후 어성초 추출물의 희석액으로 사용하였다. MRSA 10 균주는 어성초 추출물 4,096 μg/mL, 8,192 μg/mL, 10,000 μg/mL, 20,000 μg/mL, 30,000 μg/mL 농도를 이용한 디스크 확산법에서 억제대가 관찰되지 않았다(Fig. 1A). CRAB 및 VRE 세균배양에서도 동일한 결과를 보였다(Fig. 1B, 1C).
Fig. 1
Disk diffusion method of Houttuynia cordata against MRSA (A), CRAB (B) and VRE (C). Concentration of H. cordata ethanol extract are 10% DMSO(1), 4,096 μg/mL (2), 8,196 μg/mL (3), 10,000 μg/mL (4), 20,000 μg/mL (5), and 30,000 μg/mL(6). All isolates showed no inhibition zone.
KJCLS_47_140_fig_1.tif

2) 미량액체배지 희석법을 이용한 최소억제농도(MIC)측정

어성초 추출물에 대한 MRSA, VRE 그리고 CRAB에 대한 최소억제 농도(MIC) 결과는 Table 2, 3, 4와 같다. MTT 염료를 이용하여 색 변화를 증식여부로 판독하였으며, MRSA의 MIC는 2,048∼4,096 μg/mL이였으며 MIC90은 4,096 μg/mL 였다. VRE의 MIC는 4,096∼8,192 μg/mL이였으며 MIC90은 8,192 μg/mL였다. CRAB의 MIC는 4,096∼8,192 μg/mL이였으며 MIC90은 4,096 μg/mL였다(Table 5). 한편 대조균주로 사용한 메치실린 감수성인 S. aureus, vancomycin 감수성 E. Faecalis, imipenem 감수성 P. aeruginosa의 MIC는 10개의 내성세균의 범위에 속하였다.
Table 5
Minimal inhibitory concentration (MIC) of clinical microorganisms against Houttuynia cordata extract by microbroth dilution method
Microorganisms (n) MIC (μg/mL)

Range MIC50 MIC90
 MRSA (10) 2,048∼4,096 4,096 4,096
 VRE (10) 4,096∼8,192 8,192 8,192
 CRAB (10) 4,096∼8,192 4,096 4,096

Abbreviations: MRSA, methicillin-resistant Staphylococcus aureus; VRE, vancomycin-resistant Enterococcus faecium; CRAB; carbapenem-resistant Acinetobacter baumannii.

고찰

내성세균의 증가는 공중 보건학적으로 커다란 문제를 야기하고 있으며, 이러한 문제를 해결하기 위해 항생물질 대체제의 개발이 중요한 대안으로 제시되고 있다(Mahady GB., 2005; Chin 등, 2008). 천연물에 대한 항균효과는 주로 디스크 확산법과 액체배지 희석법을 사용하고 있는데 국내에서는 디스크 확산법을 주로 이용하고 있으며, 디스크 확산법과 액체배지 희석법을 병행하고 있다. 한편 국외의 경우는 액체배지 희석법으로 MIC를 측정하거나 항생제들과의 시너지효과를 측정하기도 한다(Lu 등, 2013). 본 연구에서는 대표적인 다제내성세균인 MRSA 10균주, VRE 10균주 그리고 CRAB 10균주를 대상으로 어성초 에탄올 추출물의 항균효과를 측정하기 위해 병원 미생물 검사실에서 통상적으로 사용하는 CLSI 기준에 기초한 디스크 확산법과 미량약체배지희석법을 이용하였다. CLSI 기준에 의한 McFarland 0.5관의 균농도를 이용한 디스크 확산법에서 시험균주는 4,096 μg/mL, 8,196 μg/mL, 10,000 μg/mL, 20,000 μg/mL, 30,000 μg/mL 농도 모두에서 억제대가 관찰되지 않았다. 그러나 액체배지 희석법에서는 MRSA, VRE, CRAB의 MIC90이 각각 4,096 μg/mL, 8,192 μg/mL, 4,096 μg/mL를 보였다(Table 2, 3, 4, 5). 디스크 확산법은 액체배지 희석법보다 검사과정이 쉬우므로 많이 이용하지만 디스크 확산법에 사용하는 균농도(0.5 McFarland: 1.5×108 CFU/mL)가 액체배지 희석법의 균농도(최종농도 1×105 CFU/mL)보다 높고, 천연물의 추출물이 항생제보다 항균효과가 매우 낮거나 배지에서 어성초의 확산성이 좋지 않기 때문에 억제대가 관찰되지 않았을 수 있을 것으로 사료된다. 따라서 천연물의 항균효과 측정은 디스크 확산법보다 액체배지 희석법으로 표준화하는 것이 좋을 것으로 사료된다. 한편 다양한 방법으로 어성초의 항균효과에 대한 연구들이 있었는데, Kim 등(2008)Salmonella의 항균실험방법에서 어성초 추출물과 균액을 섞은 후 배양하여 직접 살균효과를 보는 연구를 시행하였다. Song 등(2003)은 그람양성 및 음성균에 대한 어성초 에탄올 추출물의 항균실험을 디스크 확산법으로 했으나 균 접종농도를 표기하지 않고 단지 10,000 μg, 15,000 μg, 20,000 μg 농도에서 억제대가 각각 9.2 mm, 9.8 mm, 11.0 mm로 항균효과가 있다고 보고하고 있다. 또한 Lu 등(2006)은 어성초 에센스 오일로 MIC를 측정하여 항균효과를 보았다고 보고하였고, Lu 등(2013)은 어성초 단일 물질인 Sodium New Houttuyfonate에서 MRSA에 대한 항균효과가 MIC90에서 32 μg/mL로 보고하기도 하였다. 이처럼 다양한 실험방법을 사용하였고 균의 접종농도 및 천연물 농도를 정확히 표기하지 않는 등 항균효과 활성 측정 방법에 대한 표준화가 되지 않아 천연물의 항균효과 정도를 논문을 통하여 비교하는 것은 매우 어렵다. 어성초 외의 다른 천연물 항균결과들의 경우에도, Lee 등(2010)은 에탄올 추출 승마갈근탕이 S. aureus 대하여 4 mg/disc에서 1.40 cm 억제대를 보였고, MIC는 5 mg/mL로 보고하였다. 한편 Shin과 Sung (2006)은 백작약 추출물의 MRSA에 대한 항균효과를 MIC 50 mg/mL이라고 보고하였으며, 디스크 확산법으로 MIC를 측정하였다. 그리고 Lee 등(2011)은 마늘 추출물에서 VRE에 대해 디스크 확산법의 억제대가 50% 농도에서 13 mm이므로 항균효과가 있다고 보고하는 등 표준화되지 않은 다양한 방법으로 결과를 보고하고 있다.
한편 아직까지 임상에서 흔히 관찰되며 치료에서 선택할 수 있는 항생제가 적은 VRE나 CRAB에 대한 어성초의 항균효과에 대한 연구는 아직 없었으나 이번 연구에서 어성초는 이들 균에 대해서도 항균효과를 보였다(Table 3, 4, 5). 앞으로 어성초 단독으로 이들 균의 치료에 사용하기 어렵기 때문에 다양한 항균제의 상승효과에 대한 추가 연구도 필요할 것이다(Amin 등, 2015).
결론적으로 어성초 추출물은 액체배지 희석법에 의해 주요 내성균인 MRSA, VRE 및 CRAB에서 의미 있는 항균효과를 보였다. 그러나 디스크 확산법으로는 이들의 항균효과를 증명할 수 없었다. 따라서 천연물의 항균력을 측정할 때 디스크 확산법 보다 표준화된 액체배지 희석법이 우수하며, 만약 디스크 확산법을 이용하려면 균의 농도를 낮추는 등 표준화된 기준에 대한 추가적인 연구가 필요하겠다.

Acknowledgements

None

References

1. Amin MU, Khurram M, Khattak B, Khan J. Antibiotic additive and synergistic action of rutin, morin and quercetin against methicillin resistant Staphylococcus aureus. BMC Complement Altern Med. 2015; 15:59–72. DOI: 10.1186/s12906-015-0580-0. PMID: 25879586. PMCID: PMC4364681.
[CrossRef] [Google Scholar]
2. Brakstad OG, Aasbakk K, Maeland JA. Detection of Staphylococcus aureus by polymerase chain reaction amplication of the nuc gene. J Clin Microbiol. 1992; 30:1654–60. PMID: 1629319. PMCID: PMC265359.
[Google Scholar]
3. Chin JN, Jones RN, Sader HS, Savage PB, Rybak MJ. Potential synergy activity of the novel ceragenin, CSA-13, against clinical isolates of Pseudomonas aeruginosa, including multidrug- resistant P. aeruginosa. J Antimicrob Chemother. 2008; 61:365–370. DOI: 10.1093/jac/dkm457. PMID: 18079128.
[Google Scholar]
4. Cho WC, Kim JI, Kim MJ. Microbiological effects of xanthorrhizol and Houttuynia cordata Thunb. extract. J Korean Oil Chemists’ Soc. 2008; 25:269–274.
[Google Scholar]
5. Chung HS, Lee YS, Park ES, Lee DS, Ha EJ, Kim MS, et al. Characterization of the multidrug-resistant Acinetobacter species causing a nosocomial outbreak at intensive care units in a Korean teaching hospital. Ann Clin Microbiol. 2014; 17:29–34. DOI: 10.5145/ACM.2014.17.2.29.
[CrossRef] [Google Scholar]
6. Clinical Laboratory Standards Institute. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard (M07-A9), CLSI. 2012. PA: Wayne.
7. Depardieu F, Perichon B, Courvalin P. Detection of the van alphabet and identification of Enterococci and Staphylococci at the species level by multiplex PCR. J Clin Microbiol. 2004; 42:5857–5860. DOI: 10.1128/JCM.42.12.5857-5860.2004. PMID: 15583325. PMCID: PMC535300.
[CrossRef] [Google Scholar]
8. Hong SB, Yum JH, Kim YY, Shin KS. Trends in pathogen occurrence and antimicrobial resistance of urinary isolates in a tertiary medical center over ten years 2004-2013. Biomedical Science Letters. 2015; 21:84–91. DOI: 10.15616/BSL.2015.21.2.84.
[ScienceCentral] [CrossRef] [Google Scholar]
9. Hong SB. 2013 Academic research Report of the Korean association of quality assurance for clinical laboratory. Korean Assoc Qual Assur Clin Lab. 2013; 7–9.
[Google Scholar]
10. Jang MJ, Kim YH, An BJ, Lee CE, Lee JT, Kim SH, et al. Study on anti-inflammatory and anti-microbial effect of Pinusrigida Mill. Inner bark extracts as a cosmetic material. J Korean For Soc. 2008; 97:215–220.
[Google Scholar]
11. Jeong HR, Kwak JH, Kim JH, Choi GN, Jeong CH, Heo HJ. Antioxidant and neuronal cell protective effects of an extract of Houttuynia cordata Thunb. Korean J Food Preserv. 2010; 17:720–726.
[Google Scholar]
12. Jo SH, Cho CY, Ha KS, Choi EJ, Kang YR, Kwon YI. The antioxidant and antimicrobial activities of extracts of selected barley and wheat inhabited in Korean Peninsula. J Korean Soc Food Sci Nutr. 2013; 42:1003–1007. DOI: 10.3746/jkfn.2013.42.7.1003.
[CrossRef] [Google Scholar]
13. Jorgensen JH, Turnidge JD. Susceptibility test methods; dilution and disk diffusion methods. Manual of clinical microbiology. 2007. 9th ed. Washington, D.C: ASM press;p. 1152–1172.
14. Kim CH, Lee JY, Kim MK, Kim SH, Park GY, Bae SY, et al. Isolation rate of methicillin-resistant Staphphylococcus aureus (MRSA) from nasal cavity inferior regions and cellular phones. Korean J Clin Lab Sci. 2012; 44:118–123.
[Google Scholar]
15. Kim DH, Lim JJ, Lee JJ, Jung WC, Shin HJ, Lee HJ, et al. Antibacterial and therapeutic effects of Houttuynia cordata ethanol extract for murine Salmonellosis. Korean J Environ Agric. 2008; 27:156–162. DOI: 10.5338/KJEA.2008.27.2.156.
[CrossRef] [Google Scholar]
16. Kim SK, Ryu SY, Choi SU, Kim YS. Cytotoxic alkaloids from Houttuynia cordata. Arch Pharm Res. 2001; 24:518–521. DOI: 10.1007/BF02975156. PMID: 11794526.
[CrossRef] [Google Scholar]
17. Kim WJ, Cho JY, Choi CS, Yoon GS, Lee WK, Ryu YW. Antimicrobial activity of extracted by supercritical fluid from Origanumvulgare, Cinnamomum cassia, Chamaecyparisobtuse and Scutellariaebaicalensis. Korean J Biotechnol Bioeng. 2008; 23:147–152.
[Google Scholar]
18. Lee JY, Bae HJ, Park TS, Kim TY, Moon DH, Kwon OJ, et al. Anti-oxidant and anti-microbial activities of Seungma galgeuntang. J Appl Biol Chem. 2010; 53:13–20. DOI: 10.3839/jabc.2010.003.
[CrossRef] [Google Scholar]
19. Lee WW, Lee SM, Lee GR, Kim GH. Antimicrobial effects of galic extract against pathogenic bacteria. The annual report of Busan metropolitan city institution of health & environment. 2011; 20:231–246.
[Google Scholar]
20. Liu IX, DG Durham, RM Richards. Baicalin synergy with β-lactam antibiotics against methicillin-resistant Staphylococcus sureus other β-Lactam-resistant strains of S. aureus. J Pharm Pharmacol. 2000; 52:361–366. DOI: 10.1211/0022357001773922. PMID: 10757427.
[CrossRef] [Google Scholar]
21. Lu H, Wu X, Liang Y, Zhang J. Variation in chemical composition and ntibacterial ctivities of essential oils from two species of Houttuynia Thunb. Chem Pharm Bull. 2006; 54:936–940. DOI: 10.1248/cpb.54.936.
[CrossRef] [Google Scholar]
22. Lu X, Yang X, Li X, Lu Y, Ren Z, Zhao L, et al. In vitro activity of sodium new Houttuyfonate alone and in combination with oxacillin or netilmicin against methicillin-resistant Staphylococcus aureus. PLOS one. 2013; 8:e68053–e68060. DOI: 10.1371/journal.pone.0068053. PMID: 23844154. PMCID: PMC3699466.
[CrossRef] [Google Scholar]
23. Mahady GB. Medicinal plants for the prevention and treatment of bacterial infections. Curr Pharm Des. 2005; 11:2405–2427. DOI: 10.2174/1381612054367481. PMID: 16026296.
[CrossRef] [Google Scholar]
24. Park SO, Park BS, Ryu CM, Ahn YS. Effect of herb extracts mixed with Houttuynia cordata on antiatopic dermatitis in DNCB-induced BALB/c mouse. J Korean Oil Chemists’ Soc. 2012; 29:175–183.
[Google Scholar]
25. Shin SH, Sung IH. Antimicrobial activities of the extracts from Paeonia japonica against MRSA. Korean J Microbiol. 2006; 42:54–58.
[Google Scholar]
26. Song JH, Kim MJ, Kwon HD, Park IH. Antimicrobial activity of fractional eatracts of Houttuynia Cordara root. J Korean Soc Food Nutr. 2003; 32:1053–1058. DOI: 10.3746/jkfn.2003.32.7.1053.
[CrossRef] [Google Scholar]
27. Woodford N, Ellington M. J, Turton J. F, Ward M. E, Brown S, Amyes S. G, Livermore D. M. Multiplex PCR for genes encording prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006; 27:351–353. DOI: 10.1016/j.ijantimicag.2006.01.004. PMID: 16564159.
[CrossRef] [Google Scholar]
28. Yang BS, Park JY, Choi SG. Rapid detection of vancomycin-resistant Enterococci (VRE) in clinical samples from university hospital. Korean J Clin Lab Sci. 2013; 45:16–20.
[Google Scholar]

Notes

Funding: None

Conflict of interest: None

Formats:
Article | 
PDF LinksPDF(578K) | PubReaderPubReader | EpubePub | 
Download Citation
Share  |
         
METRICS
2,344
View
42
Save
3
Cited-By
In This Page: